Basic information from miRBase |
hairpin accession number: MI0013529 |
Located between position 574909 and 574989 on chromosome CH477702.1 strand + |
mature miRNAs for MI0013529: |
aae-miR-9a (MIMAT0014323): TCTTTGGTTATCTAGCTGTATGA |
References |
[1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
more data |
Data from CoGemiR |