| Basic information from miRBase |
| hairpin accession number: MI0001574 |
| Located between position 1302336 and 1302422 on chromosome Group14.24 strand + |
| mature miRNAs for MI0001574: |
| ame-bantam (MIMAT0001470): TGAGATCATTGTGAAAGCTGATT |
| You can find this miRNA in ENTREZGENE: Bantam (accession: 732515) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |