| Basic information from miRBase |
| hairpin accession number: MI0005728 |
| Located between position 74561 and 74660 on chromosome Group8.27 strand + |
| mature miRNAs for MI0005728: |
| ame-miR-100 (MIMAT0004420): AACCCGTAGATCCGAACTTGTG |
| You can find this miRNA in ENTREZGENE: Mir100 (accession: 100315658) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |