| Basic information from miRBase |
| hairpin accession number: MI0005729 |
| Located between position 281270 and 281369 on chromosome Group14.17 strand + |
| mature miRNAs for MI0005729: |
| ame-miR-137 (MIMAT0004421): TTATTGCTTGAGAATACACGTA |
| You can find this miRNA in ENTREZGENE: Mir137 (accession: 100315659) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |