miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005730
Located between position 136460 and 136559 on chromosome Group1.1 strand -
mature miRNAs for MI0005730:
         ame-miR-13a (MIMAT0004422): TATCACAGCCATTTTGATGAG
You can find this miRNA in ENTREZGENE: Mir13a (accession: 100315660)

References
[1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome"