| Basic information from miRBase |
| hairpin accession number: MI0005733 |
| Located between position 624376 and 624475 on chromosome Group4.22 strand + |
| mature miRNAs for MI0005733: |
| ame-miR-275 (MIMAT0004424): TCAGGTACCTGAAGTAGCGCGCG |
| You can find this miRNA in ENTREZGENE: Mir275 (accession: 100315663) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |