| Basic information from miRBase |
| hairpin accession number: MI0001586 |
| Located between position 128925 and 129016 on chromosome Group8.46 strand + |
| mature miRNAs for MI0001586: |
| ame-miR-278 (MIMAT0001482): TCGGTGGGACTTTCGTCCGTTT |
| You can find this miRNA in ENTREZGENE: Mir278 (accession: 732502) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |