| Basic information from miRBase |
| hairpin accession number: MI0005734 |
| Located between position 103334 and 103433 on chromosome Group5.26 strand + |
| mature miRNAs for MI0005734: |
| ame-miR-279 (MIMAT0004425): TGACTAGATCCACACTCATTAA |
| You can find this miRNA in ENTREZGENE: Mir279 (accession: 100315664) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |