| Basic information from miRBase |
| hairpin accession number: MI0016170 |
| Located between position 908 and 1042 on chromosome GroupUn.4084 strand - |
| mature miRNAs for MI0016170: |
| ame-miR-3766 (MIMAT0018540): TAGGTGGTTTTGAAAATGACG |
| References |
| [1]Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" |