| Basic information from miRBase |
| hairpin accession number: MI0001597 |
| Located between position 20325 and 20416 on chromosome Group15.33 strand - |
| mature miRNAs for MI0001597: |
| ame-miR-9b (MIMAT0001492): GCTTTGGTAATCTAGCTTTATGA |
| You can find this miRNA in ENTREZGENE: Mir9b (accession: 732513) |
| References |
| [1]Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG, Genome Biol. 8:R97(2007)., "Computational and transcriptional evidence for microRNAs in the honey bee genome" |