| Basic information from miRBase |
| hairpin accession number: MI0013921 |
| Located between position 42795 and 42856 on chromosome gb|ABLF01003185.1| strand + |
| mature miRNAs for MI0013921: |
| api-miR-275 (MIMAT0014721): TCAGGTACCTGAAGTAGCGCG |
| References |
| [1]Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" |