miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013952
Located between position 11312 and 11371 on chromosome gb|ABLF01021579.1| strand -
mature miRNAs for MI0013952:
         api-miR-996 (MIMAT0014746): TGACTAGAGTTACACTCGTCA

References
[1]Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S, BMC Genomics. 11:281(2010)., "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum"