| Basic information from miRBase |
| hairpin accession number: MI0018109 |
| Located between position 4336022 and 4336167 on chromosome Bd3 strand - |
| mature miRNAs for MI0018109: |
| bdi-miR156c (MIMAT0020684): TGACAGAAGAGAGTGAGCAC |
| References |
| [1]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" |