| Basic information from miRBase |
| hairpin accession number: MI0018122 |
| Located between position 18202182 and 18202332 on chromosome Bd5 strand - |
| mature miRNAs for MI0018122: |
| bdi-miR156d (MIMAT0020697): TGACAGAAGAGAGTGAGCAC |
| References |
| [1]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" |