| Basic information from miRBase |
| hairpin accession number: MI0018213 |
| Located between position 49592002 and 49592134 on chromosome Bd3 strand + |
| mature miRNAs for MI0018213: |
| bdi-miR162 (MIMAT0020738): TCGATAAACCTCTGCATCCGG |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |