| Basic information from miRBase |
| hairpin accession number: MI0018215 |
| Located between position 26808982 and 26809108 on chromosome Bd2 strand - |
| mature miRNAs for MI0018215: |
| bdi-miR164e (MIMAT0020740): TGGAGAAGCAGGGCACGTGCA |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |