| Basic information from miRBase |
| hairpin accession number: MI0018216 |
| Located between position 19949341 and 19949501 on chromosome Bd2 strand + |
| mature miRNAs for MI0018216: |
| bdi-miR164f (MIMAT0020741): TGGAGAAGAAGGGCACATGCA |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |