miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011561
Located between position 6349045 and 6349135 on chromosome Bd1 strand +
mature miRNAs for MI0011561:
         bdi-miR167a (MIMAT0012176): TGAAGCTGCCAGCATGATCTA

References
[1]Unver T, Budak H, Planta. 230:659-669(2009)., "Conserved microRNAs and their targets in model grass species Brachypodium distachyon"
[2]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"