| Basic information from miRBase |
| hairpin accession number: MI0018095 |
| Located between position 54067075 and 54067233 on chromosome Bd1 strand + |
| mature miRNAs for MI0018095: |
| bdi-miR167c (MIMAT0020670): TGAAGCTGCCAGCATGATCTGA |
| References |
| [1]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" |