| Basic information from miRBase |
| hairpin accession number: MI0018084 |
| Located between position 6911133 and 6911296 on chromosome Bd1 strand + |
| mature miRNAs for MI0018084: |
| bdi-miR171b (MIMAT0020659): TGATTGAGCCGTGCCAATATC |
| References |
| [1]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" |