| Basic information from miRBase |
| hairpin accession number: MI0018081 |
| Located between position 16374432 and 16374612 on chromosome Bd4 strand + |
| mature miRNAs for MI0018081: |
| bdi-miR395a (MIMAT0020656): TGAAGTGTTTGGGGGAACTC |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |
| [2]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" |