| Basic information from miRBase |
| hairpin accession number: MI0018222 |
| Located between position 25455723 and 25455811 on chromosome Bd5 strand + |
| mature miRNAs for MI0018222: |
| bdi-miR395g (MIMAT0020747): TGAAGTGTTTGGGGGAACTC |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |