| Basic information from miRBase |
| hairpin accession number: MI0018223 |
| Located between position 25455882 and 25455957 on chromosome Bd5 strand + |
| mature miRNAs for MI0018223: |
| bdi-miR395h (MIMAT0020748): TGAAGTGTTTGGGGGAACTC |
| References |
| [1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |