Basic information from miRBase |
hairpin accession number: MI0018224 |
Located between position 25456151 and 25456238 on chromosome Bd5 strand + |
mature miRNAs for MI0018224: |
bdi-miR395j (MIMAT0020749): TGAAGTGTTTGGGGGAACTC |
References |
[1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |