miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0018226
Located between position 25456562 and 25456657 on chromosome Bd5 strand +
mature miRNAs for MI0018226:
         bdi-miR395l (MIMAT0020751): TGAAGTGTTTGGGGGAACTC

References
[1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response"