| Basic information from miRBase |
| hairpin accession number: MI0018134 |
| Located between position 42126781 and 42127074 on chromosome Bd4 strand - |
| mature miRNAs for MI0018134: |
| bdi-miR5167 (MIMAT0020709): CCACTTTGGGTGTCATTGGTA |
| References |
| [1]Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G, Genomics. [Epub prior to print](2011)., "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" |