Basic information from miRBase |
hairpin accession number: MI0018229 |
Located between position 44898509 and 44898615 on chromosome Bd3 strand + |
mature miRNAs for MI0018229: |
bdi-miR529 (MIMAT0020754): AGAAGAGAGAGAGTACAGCCT |
References |
[1]Zhang J, Xu Y, Huan Q, Chong K, BMC Genomics. 10:449(2009)., "Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response" |