miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013858
Located between position 344959 and 345075 on chromosome nscaf2176 strand -
mature miRNAs for MI0013858:
         bmo-miR-2733a (MIMAT0012611): TCACTGGGTGCATGATGATTGT

References
[1]Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R, BMC Genomics. 11:52(2010)., "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development"