miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012333
Located between position 700920 and 701000 on chromosome nscaf2876 strand -
mature miRNAs for MI0012333:
         bmo-miR-2775a (MIMAT0013659): CGCGGGAGAAAAGTAGGACATT

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"