miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012429
Located between position 1275550 and 1275627 on chromosome nscaf2883 strand -
mature miRNAs for MI0012429:
         bmo-miR-2775b (MIMAT0013745): AGTAGGACGTTTCCTCCCGCGTG

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"