miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012359
Located between position 2512715 and 2512788 on chromosome nscaf3063 strand +
mature miRNAs for MI0012359:
         bmo-miR-2786 (MIMAT0013682): AGGTTATGCAGGCGAAGGAATA

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"