miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012360
Located between position 7943103 and 7943200 on chromosome nscaf3058 strand -
mature miRNAs for MI0012360:
         bmo-miR-2787* (MIMAT0013683): TATCTTGAATTTGATTAGCACTAAA
         bmo-miR-2787 (MIMAT0013684): TGAGAAAGTTCCACGATGTGCATG

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"