miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012376
Located between position 334259 and 334344 on chromosome nscaf2830 strand +
mature miRNAs for MI0012376:
         bmo-miR-2800 (MIMAT0013704): AGAATATTGTGTCTTGTAAACTT

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"