miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012391
Located between position 75 and 152 on chromosome scaffold42075 strand -
mature miRNAs for MI0012391:
         bmo-miR-2804* (MIMAT0013709): GTAGTGTATTACAATACAAAGT
         bmo-miR-2804 (MIMAT0013710): TTTGCATTGTAATACACTGTTA

References
[1]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"