miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010005
Located between position 3476510 and 3476597 on chromosome nscaf2853 strand +
mature miRNAs for MI0010005:
         bmo-miR-iab-4-5p (MIMAT0009162): ACGTATACTGAATGTATCCTGA
         bmo-miR-iab-4-3p (MIMAT0009163): CGGTATACCTTCAGTATACGTAAC

References
[1]Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J, PLoS One. 3:e2997(2008)., "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
[2]Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q, BMC Genomics. 11:148(2010)., "MicroRNAs of Bombyx mori identified by Solexa sequencing"