| Basic information from miRBase |
| hairpin accession number: MI0011288 |
| Located between position 191 and 341 on chromosome EM:ED537952 strand - |
| mature miRNAs for MI0011288: |
| bna-miR2111a (MIMAT0011782): TAATCTGCATCCTGAGGTTTA |
| bna-miR2111a* (MIMAT0011783): GTCCTCGGGATGCGGATTACC |
| References |
| [1]Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR, Plant Physiol. 150:1541-1555(2009)., "Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing" |