| Basic information from miRBase |
| hairpin accession number: MI0005007 |
| Located between position 39116883 and 39116991 on chromosome 19 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSBTAT00000061532) |
| mature miRNAs for MI0005007: |
| bta-miR-10a (MIMAT0003786): TACCCTGTAGATCCGAATTTGTG |
| You can find this miRNA in ENTREZGENE: MIR10A (accession: 791006) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |
| [2]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" |