| Basic information from miRBase |
| hairpin accession number: MI0005012 |
| Located between position 108876544 and 108876641 on chromosome 1 strand - |
| Overlapping with sense strand of Q05B94_BOVIN (intron 5). |
| (Ensemble: ENSBTAT00000052946) |
| mature miRNAs for MI0005012: |
| bta-miR-15b (MIMAT0003792): TAGCAGCACATCATGGTTTACA |
| You can find this miRNA in ENTREZGENE: MIR15B (accession: 791011) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |
| [2]Gu Z, Eleswarapu S, Jiang H, FEBS Lett. 581:981-988(2007)., "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" |