| Basic information from miRBase |
| hairpin accession number: MI0009753 |
| Located between position 18887597 and 18887685 on chromosome 12 strand - |
| mature miRNAs for MI0009753: |
| bta-miR-16a (MIMAT0009242): TAGCAGCACGTAAATATTGGTG |
| You can find this miRNA in ENTREZGENE: MIR16A (accession: 100313007) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |