| Basic information from miRBase |
| hairpin accession number: MI0005461 |
| Located between position 64665681 and 64665767 on chromosome 12 strand + |
| mature miRNAs for MI0005461: |
| bta-miR-19b (MIMAT0004337): TGTGCAAATCCATGCAAAACTGA |
| You can find this miRNA in ENTREZGENE: MIR19B (accession: 100170927) |
| References |
| [1]Gu Z, Eleswarapu S, Jiang H, FEBS Lett. 581:981-988(2007)., "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" |
| [2]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |