| Basic information from miRBase |
| hairpin accession number: MI0012209 |
| Located between position 181139 and 181221 on chromosome Un.004.53 strand - |
| Overlapping with sense strand of (exon 1). |
| (Ensemble: ENSBTAT00000042164) |
| mature miRNAs for MI0012209: |
| bta-miR-19b (MIMAT0004337): TGTGCAAATCCATGCAAAACTGA |
| You can find this miRNA in ENTREZGENE: MIR19B-2 (accession: 100498837) |
| References |
| [1]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |