| Basic information from miRBase |
| hairpin accession number: MI0011307 |
| Located between position 38813843 and 38813915 on chromosome 11 strand - |
| Overlapping with antisense strand of Q1RMK4_BOVIN (intron 24). |
| (Ensemble: ENSBTAT00000009208) |
| mature miRNAs for MI0011307: |
| bta-miR-2297 (MIMAT0011805): CACTCTTTTTTCTTATTCCT |
| You can find this miRNA in ENTREZGENE: MIR2297 (accession: 100313122) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |