| Basic information from miRBase |
| hairpin accession number: MI0011318 |
| Located between position 39508063 and 39508128 on chromosome 13 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSBTAT00000056271) |
| mature miRNAs for MI0011318: |
| bta-miR-2305 (MIMAT0011817): CGGGGGTGGCGGGGAGGGGG |
| You can find this miRNA in ENTREZGENE: MIR2305 (accession: 100313127) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |