| Basic information from miRBase |
| hairpin accession number: MI0011319 |
| Located between position 55596385 and 55596463 on chromosome 13 strand + |
| Overlapping with sense strand of (intron 11). |
| (Ensemble: ENSBTAT00000060959) |
| mature miRNAs for MI0011319: |
| bta-miR-2306 (MIMAT0011818): CAGGCCTGCCCATCTAGGACAC |
| You can find this miRNA in ENTREZGENE: MIR2306 (accession: 100313128) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |