| Basic information from miRBase |
| hairpin accession number: MI0011327 |
| Located between position 75494398 and 75494452 on chromosome 14 strand - |
| Overlapping with sense strand of SNORA61 (exon 1). |
| (Ensemble: ENSBTAT00000060503) RFAM: RFAM) |
| mature miRNAs for MI0011327: |
| bta-miR-2311 (MIMAT0011826): TACTGAAACTGTGCTCGTGGTGT |
| You can find this miRNA in ENTREZGENE: MIR2311 (accession: 100313132) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |