| Basic information from miRBase |
| hairpin accession number: MI0009761 |
| Located between position 85962806 and 85962873 on chromosome 8 strand + |
| mature miRNAs for MI0009761: |
| bta-miR-24 (MIMAT0009250): GTGCCTACTGAGCTGATATCAGT |
| You can find this miRNA in ENTREZGENE: MIR24-1 (accession: 100313011) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |