| Basic information from miRBase |
| hairpin accession number: MI0011548 |
| Located between position 23441113 and 23441174 on chromosome X strand - |
| Overlapping with sense strand of HCFC1 (intron 3). |
| (Ensemble: ENSBTAT00000015793) |
| mature miRNAs for MI0011548: |
| bta-miR-2485 (MIMAT0012079): TTTCTAGAATCTGCAGGTAGT |
| You can find this miRNA in ENTREZGENE: MIR2485 (accession: 100313350) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |