miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0005067

Located between position 38455975 and 38456058 on chromosome 25 strand +

Overlapping with sense strand of MCM7_BOVIN (intron 13).

(Ensemble: ENSBTAT00000003728)

mature miRNAs for MI0005067:

bta-miR-25 (MIMAT0003853): CATTGCACTTGTCTCGGTCTGA

You can find this miRNA in ENTREZGENE: MIR25 (accession: 791066)

References

[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"

[2]Gu Z, Eleswarapu S, Jiang H, FEBS Lett. 581:981-988(2007)., "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"

[3]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"