| Basic information from miRBase |
| hairpin accession number: MI0009784 |
| Located between position 11464097 and 11464186 on chromosome 22 strand + |
| Overlapping with sense strand of CTDSPL (intron 4). |
| (Ensemble: ENSBTAT00000017828) |
| mature miRNAs for MI0009784: |
| bta-miR-26a (MIMAT0003516): TTCAAGTAATCCAGGATAGGCT |
| You can find this miRNA in ENTREZGENE: MIR26A-1 (accession: 100313309) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [2]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |
| [3]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |