miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0004731

Located between position 60085852 and 60085935 on chromosome 5 strand +

Overlapping with sense strand of Q2KJ43_BOVIN (intron 5).

(Ensemble: ENSBTAT00000038164)

mature miRNAs for MI0004731:

bta-miR-26a (MIMAT0003516): TTCAAGTAATCCAGGATAGGCT

You can find this miRNA in ENTREZGENE: MIR26A-2 (accession: 790971)

References

[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"

[2]Gu Z, Eleswarapu S, Jiang H, FEBS Lett. 581:981-988(2007)., "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"

[3]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"